دانلود پایان نامه

ر دمای اتاق نگهداری شدند.
رنگ آمیزی: به منظور مطالعه لام ها با میکروسکوپ نوری، از رنگ آمیزی هماتوکسیلین- ائوزین استفاده شد. مراحل انجام رنگ آمیزی و زمانهای آن بصورت خلاصه در جدول (2-1) قید شده است.پس از انجام مراحل ذکر شده در جدول (2-1) لامل ها با استفاده از چسب انتلان بر روی لام چسبانده شدند.
مراحل
مواد
مدت زمان
حذف پارافین
گزیلول
5 دقیقه

گزیلول
5 دقیقه

آب دهی
الکل 100
3 دقیقه

الکل 100
3 دقیقه

الکل 96
3 دقیقه

الکل 70
3 دقیقه

رنگ آمیزی
محلول هماتوکسیلین
3 دقیقه

شستشو در آب جاری
4دقیقه

اسید الکل
3 ثانیه

شستشو در آب جاری
3دقیقه

محلول ائوزین
1 دقیقه و30 ثانیه

آب گیری
الکل70 درصد
1دقیفه

الکل 96درصد
1دقیقه

الکل 100 درصدІ
1دقیقه

الکل100درصدІІ
1دقیقه
شفاف سازی
گزیلولІ
5دقیقه

گزیلولІІ
5 دقیقه
جدول 2-1 مراحل رنگ آمیزی هماتوکسیلین ایوزین
2-6-بررسی آپوپتوز و بقا سلولی
جهت ارزیابی مرگ سلولی از تکنیک فلوسایتومتری و رنگ فلورسنت 41PI با قابلیت اتصال به DNA تخریب شده و جهت ارزیابی آپوپتوز سلولی از کیت AnnexinV FITC/ PI 42 استفاده شد (33).
2-6-1-هضم مکانیکی و آنزیمی بافت بیضه
2-6-1-1-هضم مکانیکی
جهت هضم مکانیکی بافت بیضه، ابتدا قطعات بیضه توسط سرنگ انسولین تکه تکه شدند و سپس به مدت 5 دقیقه سانتریفوژ (15 RPM) شدند. نهایتا رسوبات حاصل به محیط هضم آنزیمی منتقل شد.
2-6-1-2-هضم آنزیمی
الف: تهیه ی محیط هضم آنزیمی جهت تهیه محلول هضم آنزیمی، یک میلی گرم کلاژنازIV43 و یک میکروگرم DNase144 در یک سی سی محلول DMEM حل شد.
ب: هضم آنزیمی
قطعات بافتی حاصل از هضم مکانیکی، در محیط هضم آنزیمی قرار داده شدند و به مدت 20 دقیقه در انکوباتور قرار گرفتند. جهت تسهیل هضم آنزیمی، محلول هر 5 دقیقه یکبار پیپتاژ شد (33).
2-6-1-3-خنثی سازی اثر آنزیم و بررسی بقا با استفاده از رنگ PI
پس از اتمام زمان انکوباسیون، محلول حاصل از فیلتر دارای منافذ40 میکرومتری45 عبور داده شد و با اضافه کردن محیط DMEM حاوی 20% سرم FBS اثر آنزیم ها خنثی گردید. سپس محلول حاصل با دور 20 RPM و به مدت 5 دقیقه سانتریفوژ شد. به ازای هر یک میلیون سلول یک میکرولیتر رنگ PI (که با غلظت2 میلی گرم در یک میلی لیتر PBS تهیه شده بود) به محلول اضافه شد و به مدت 3-2 دقیقه در دمای اتاق قرار گرفت. در پایان ارزیابی بقای سلولی با استفاده از روش فلوسایتومتری انجام شد.
2-6-2-ارزیابی بقای سلولی به روش فلوسایتومتری
در این روش ابتدا سلولهایی که رنگ نگرفته بودند توسط دستگاه فلوسایتومتری شمارش شد و نمودار نقطه ای براساس 46SSC در محور عمودی و FSC47 در محور افقی رسم گردید، تا مختصات سلول ها و وضعیت آنها مشخص گردد. سپس نمودار دوم براساس FSC در محور افقی و FL348 در محور عمودی رسم شد و محل جمعیت سلولهای زنده در این نمودار مشخص گردید. سپس سلولهای رنگ شده توسط دستگاه شمارش شدند و با تعیین محدوده ی سلولهای زنده در نمودار دوم، درصد بقا در نمودار سوم محاسبه شد و توسط نمودار 4، درصد سلولهای زنده از لحاظ آماری مشخص گردید (شکل 2-1).

شکل2-1-ارزیابی بقای سلولی با روش فلوسایتومتری
2-6-3-بررسی آپوپتوز سلولی
وجود فسفاتیدیل سرین49 در سطح سلول از نشانه های وقوع آپوپتوز است. از آنجاییکه Annexin در حضور یون کلسیم تمایل زیادی به اتصال به فسفاتیدیل سرین دارد، بنابراین از آن در تشخیص آپوپتوز سلولی استفاده می شود (33). برای بررسی آپوپتوز سه حجم 105×5-1 سلول مورد نیاز است.
دو حجم از این سلولها با استفاده از بافر کلسیم50 1x شستشو داده شد و 100 میکرولیتر بافر کلسیم 1xو 5 میکرولیتر AnnexinV FITC به سلول های هر حجم اضافه گردید و به مدت 15 دقیقه انکوباسیون بر روی یخ و در شرایط تاریکی انجام گرفت.
پس از اتمام زمان انکوباسیون، سوسپانسیون سلولی با اضافه کردن PBS و سانتریفوژ (15 RPM به مدت 5 دقیقه) شستشو داده شد و در نهایت 100 میکرولیتر PBS و 3 میکرولیتر رنگ PI به رسوب سلولی اضافه شد.
مطابق با ارزیابی بقای سلولی، در این تست نیز ابتدا نمونه ی سلولی بدون رنگ توسط دستگاه شمارش شد و نمودار FSC vs SSC و 51 FL152 vs FL2 رسم شد تا جمعیت سلولی در محل صحیح قرار گیرد، سپس نمونه ی حاوی AnnexinV FITC برای اصلاح هم پوشانی رنگ های فلورسنت توسط دستگاه شمارش شد و در انتها نمونه ی حاوی هر دو رنگ در دستگاه شمارش شدند. آنچه به دست آمد جمعیت های مختلف سلولی بودند که در موقعیت های خاص خود قرار داشتند.

شکل2- ارزیابی وقوع آپوپتوز
A: جمعیت سلول های زنده
B: جمعیت سلولی که دچار آپوپتوز اولیه شده اند
C: جمعیت سلولی که دچار نکروز شده اند
D: جمعیت سلولی که دچار آپوپتوز ثانویه هستند
2-7-کشت بافت بیضه
قطعات بافت بیضه در گروه های کنترل و انجمادیI و II بر روی آگار به مدت 20 ساعت کشت داده شدند (45).
2-7-1-آماده سازی آگار
آگار مصرفی با غلظت 15% با استفاده از آب مقطر اتوکلاو شده تهیه و این محلول در پلیت53 6 سانتی متری ریخته شد و سپس به مدت چند ساعت در یخچال قرار گرفت تا به حالت جامد در آید، قطعات آگار جامد با استفاده از تیغ بیستوری به قطعات یک در یک سانتی متری بریده شد (45). لازم به ذکر است که آگار جامد به مدت یک ماه در یخچال قابل نگهداری است.
جهت آماده سازی قطعات برش خورده ی آگار برای کشت بافت در ، سه قطعه آگار در هر چاهک پلی
ت شش چاهکی54 قرار گرفتند و سپس محیط کشت به میزانی اضافه شد که به طور کامل سطح آگار را بپوشاند. پلیت ها به مدت یک روز در انکوباتور با دمای 34 درجه سانتیگراد و فشار 5% CO2 قرار گرفتند تا محیط کشت کاملا جایگزین آب موجود در آگار شود (45).
2-7-2-آماده سازی محیط کشت
جهت کشت قطعات بافتی در گروه های کنترل و هر دو گروه انجمادی، محیط پایه ی RPMI55 حاوی 10% سرم KOSR56 تهیه شد.
2-7-2-1-روش تهیه محیط RPMI
برای ساخت 100 میلی لیتر محیط کشت RPMI، مواد زیر به ترتیب به آب دیونیزه اضافه شدند.
Deionized water 100 ml RPMI (Gibco; Paisley; UK) 1/042 gr
Penicillin / Streptomycin (Gibco; Paisley; UK) 1ml
NaHCo3 (Sigma; MO; USA) 0/2 gr
سپس pH محیط فوق توسط دستگاه pH متر، بین 6/7-4/7 تنظیم شد و توسط فیلتر دارای منافذ با قطر 22/0 میکرومتر فیلتر و در دمای 4 درجه سانتی گراد نگهداری شد.
2-7-3-کشت بافت بیضه
پس از 24 ساعت، محیط درون چاهک ها به طور کامل خارج شد و حدود 3 میلی لیتر محیط کشت تازه به هر چاهک اضافه گردید به طوری که محیط کشت تا چهار پنجم ارتفاع آگار رسید (45)، سپس 2 قطعه بیضه بر روی هر قطعه برش آگار قرار داده شد و به مدت 20 ساعت در دمای 34درجه سانتی گراد و فشار 5% CO2 انکوبه شد.
قطعات بافتی در گروه های کنترل و انجمادی، پس از 3 و 20 ساعت برداشته شدند و ارزیابی های هیستولوژیک، آپوپتوز و مولکولی بر روی آنها انجام شد.
2-8-ارزیابی ژن های آپوپتوزی
2-8-1-نگهداری بافت در محلولRNA-later
RNA later57 محلول آبی و غیر سمی با خاصیت نفوذ سریع در بافت است، که مانع تخریب بافت و آسیب رسانی به RNAسلولی می شود. باید بافت ها پیش از قرارگیری در RNA later به قطعات کوچکتر از 5 میلی متر بریده شوند و به ازای هر قطعه ی بافتی، 5 حجم RNA later استفاده می گردد. نمونه ها پس از قرار گرفتن در RNA later برای مدت نامحدود در دمای 80- درجه ی سانتیگراد قابل نگه داری هستند
2-8-2-استخراج RNA با استفاده از ترایزول
2-8-2-1-هموژن کردن بافت58
جهت هموژن کردن بافت، به ازای هر 30 میلی گرم بافت، 500 میکرولیتر ترایزول اضافه شد و با ایجاد ضربه با تیغ بیستوری، بافت به قطعات کوچکتری تبدیل گردید. سپس ازطریق ورتکس کردن، بافت به طور کامل هموژن شد و در نهایت سوسپانسیون حاصل به مدت 5 دقیقه بر روی یخ قرار گرفت.
2-8-2-2-مرحله ی جداسازی59
100 میکرولیتر کلروفرم سرد به سوسپانسیون سلولی افزوده شد، سپس ویال به شدت تکان داده شد تا محلولی به رنگ صورتی- شیری حاصل گردد و سوسپانسیون حاصل به مدت 5 دقیقه بر روی یخ قرار گرفت. در مرحله آخر نمونه ها به مدت 15 دقیقه در دستگاه سانتریفوژ با دمای 4 درجه ی سانتیگراد و g12000 قرار گرفتند.
2-8-2-3-رسوب60RNA
پس از اتمام سانتریفوژ، فاز رویی ویال ها که حاویRNA بود به یک ویال دیگر انتقال داده شد و هم حجم آن ایزوپروپانول61 به آن اضافه گردید و به آرامی تکان داده شد، سپس نمونه به مدت یک ساعت در فریزر قرار گرفت. پس از خارج نمودن نمونه از فریزر، نمونه به مدت 14 دقیقه و با دور g12000 و با دمای 4 درجه ی سانتیگراد سانتریفوژ شد. پس از سانتریفوژ کردن رسوب کمرنگ RNA در کف ویال تشکیل گردید
2-8-2-4-شستشو62RNA
در این مرحله، اتانول 70% به رسوب RNA اضافه شد و نمونه به مدت 5 دقیقه با دمای 4 درجه ی سانتیگراد و دور g 7500 سانتریفوژ گردید و سپس رسوب ویال ها به مدت 10-15 دقیقه در زیر هود قرار گرفت تا کاملا خشک شود و در آخر به هر ویال 15 میکرولیتر آب ملکولی اضافه شد.
لازم به ذکر است کلیه ی مراحل استخراج RNA بر روی یخ و زیر هود شیمیایی و با استفاده از وسایل RNase free انجام شد.
2-8-3-بررسی کیفی RNA های استخراج شده
این مرحله از کار با استفاده از دستگاه نانودراپ انجام شد بدین منظور ابتدا دستگاه با یک میکرولیتر آب مقطر صفر شد و سپس یک میکرولیتر نمونه ی RNA بر روی دستگاه قرار گرفت و OD63 آن خوانده شد. حداکثر جذب RNA در طول موج 260 نانومتری است و در طول موج 280 نانومتری پلی‌ساکاریدها بیشترین جذب را دارند، بنابراین تعیین نسبت 260 به 280 درجه خلوص RNA را مشخص می‌نماید (باید OD بین 2-8/1) باشد.
2-8-4-تیمار نمونه یRNA با استفاده از DNase1 جهت حذف آلودگی ژنومی
اگر غلظت RNA بیش از 1000 نانو گرم در یک میکرولیتر بود ابتدا با رقیق سازی RNA غلظت آن به پایین تر از 1000 نانو گرم در یک میکرولیتر رسانده می شود و سپس به 10 میکرولیتر از RNA رقیق شده مواد زیر، اضافه می گردد.
DNAase1 2 µl
10X Reaction Buffer 2 µl
Ribolouck (20 U/ML) 2 µl
Water 4 µl
Total 20 µl
مخلوط فوق به مدت 30 دقیقه در دمای 37 درجه بر روی ترموستات قرار داده شد و پس از این زمان، 2 میکرولیتر EDTA به نمونه ها اضافه گردید.
2-8-5-سنتز cDNA
با استفاده از نسخه برداري معكوس 64RT-PCR) (، رشتة DNA از روي الگوي RNA ساخته شد. به همین منظور در این پژوهش از کیت ساخت cDNA تک رشته ای65 استفاده گردید.
براي سنتز cDNA از RNA مراحل زير به ترتیب انجام شد و به هر لوله مواد زير اضافه شد:

Total RNA 11µl
Random Hexamer (0/2 µg/µl) 1µl

Total 12 µl
– مخلوط حاصله به طور مختصر سانتريفوژ و به مدت 5 دقيقه در دماي 70 درجه سانتيگراد
انكوبه شد.
– سپس نمونه‌ها بر روي يخ قرارداده شدند و مواد زير به ترتيب به آنها اضافه شد:
Reaction buffer (5x) 4 µl
Ribonuclease inhibitor (20 U/ML) 1 µl
dNTP mix (10 mM) 2 µl

Total 19 µl
مخلوط فوق به طور مختصر سانتريفوژ و دردمای 25 درجه سانتيگراد به مدت 5 دقيقه انكوبه گرديد.
به مخلوط فوق، به مقدار 1 ميكروليتر (200 u/µl) RevertAidTM H Minus M-Mulv RT افزوده شد تا حجم کلی آن به 20 میکرولیتر برسد.
سپس به مدت 10 دقيقه در دماي 25 درجه سانتيگراد و نهايتاً به مدت يك ساعت در دماي 42 درجه سانتيگراد انكوبه شد.
در مرحله بعد به منظور غيرفعال کردن آنزيم RT، مخلوط فوق به مدت 10 دقيقه در 70 درجه سانتيگراد انكوبه شد. مراحل فوق در دستگاه Thermal cycler66 انجام شد.
نهایتاً محصول بدست آمده در دماي 20- درجه سانتيگراد نگهداري گردید.
2-8-6-پرایمر
2-8-6-1-آماده سازی پرایمرها
در این پژوهش از ژن خانه دار67GAPDH به عنوان کنترل داخلی استفاده شد. ابتدا پرایمرهای ژن های مورد نظر توسط نرم افزارPerl Primer طراحی شدند و جهت اطمینان از اختصاصی بودن محل اتصال، در سایت NCBI، BLAST شدند. سپس تمامی پرایمرها بصورت لیوفیلیزه68 تهیه گردیدند و به هر یک، حجم مشخصی از آب مقطر استریل اضافه شد. غلظت حاصله 100 پیکومول بود که از آنها غلظت 5 پیکومول ساخته شد و این پرایمرها به عنوان پرایمر Working مورد استفاده قرار گرفتند.
Accession Number
Product Length
(bp)
Primer sequence (5’→3′)
Gene
NM_007987/2
175
TTTGCTGTCAACCATGCCA

TCCACCTCTAAACCATGCTC

FAS-F

FAS-R

NM_010177/4
179
ATCACAACCACTCCCACTG

GGTTGGTGAACTCACGGAG

FAS ligand-F

FAS ligand-R

NM_009741/4
214
GAGACTTCCCTGCTGAAAGAC

TCCAGAAGCCTTTGTTTCCTC

BCL2-F

BCL2-R

NM_007527/3
246
TTGCTACAGGGTTTCATCCAG

CCAGTTGAAGTTGCCATCAG

BAX-F

BAX-R

NM_009810/3
138
AAAGACCATACATGGGAGCA

CGAGATGACATTCCAGTGCT

Caspase-3-F

Caspase-3-R

NM_001127233/1
203
AACTTACCAGGGCAACTATG
TGTGCTGTGACTTCTTGTAG

TP53-F

TP53-R

NM_001289726
125
GACTTCAACAGCAACTCCCAC
TCCACCACCCTGTTGCTGTA
GAPDH-F
GAPDH-F
جدول2-2-مشخصات


دیدگاهتان را بنویسید