دانلود پایان نامه

بافر RPE به فیلتر اضافه گردید و سانتریفیوژ، مشابه مرحلهی 5 صورت پذیرفت.
7- پس از حذف محلول عبور کرده از فیلتر، µl 500 اتانول 80% بر روی فیلتر ریخته شد و به مدت 2 دقیقه با شرایط g 9167 سانتریفیوژ گردید.
8- محلول عبور کرده از فیلتر دور ریخته شد. سانتریفیوژ برای مدت 5 دقیقه با شرایطی مشابه مرحلهی قبل انجام شد.
9- فیلتر درون میکروتیوب جدید قرار داده شد. پس از اضافه کردن µl 14 آب عاری از آنزیمهای تجزیه کننده RNA بر روی فیلتر، سانتریفیوژ به مدت 1 دقیقه با شرایط g 9167 صورت پذیرفت. در این مرحله، محلول عبور کرده از فیلتر، حاوی RNA است که برای مراحل بعدی استفاده میشود.

2-6-2 ساخت cDNA148
ساخت cDNA، درون میکروتیوبهای کیت (K-2101, Bioneer) و در واکنشی به حجم lµ 20 صورت پذیرفت. مواد مورد نیاز برای این واکنش، مطابق با مقادیر درج شده درجدول ‏23، با یکدیگر ترکیب شدند و میکروتیوب حاوی این مواد تحت شرایط ذکر شده درجدول ‏24 درون دستگاه ترموسایکلر 149(Peqlab, PeqSTAR 96, United Kingdom) قرار گرفت.
جدول ‏23: مواد مورد استفاده جهت ساخت cDNA
ماده
حجم (lµ)
پرایمر شش نوکلئوتیدی تصادفی150 (pmol/µl 100)
5/1
آب عاری از نوکلئاز151
5/12
RNA
6
حجم نهايي
20

جدول ‏24: چرخههای حرارتی ساخت cDNA
مرحله
تعداد چرخه
دما ((C)
زمان (min)
اتصال152 پرایمر
1
15
3
cDNAساخت
1
50
60
غیرفعال شدن
1
95
5

2-6-3 طراحی پرایمر
پرایمرهای رفت153 و برگشت154 ژنهای Gata6، Grb2 و 155B2m (به عنوان ژن کنترل داخلی156) به کمک نرمافزار Oligo 5 طراحی شدند و از نظر اختصاصیت، در سایت NCBI و در بخشPrimer Blast مورد ارزیابی قرار گرفتند (جدول ‏25). در نهایت ساخت این پرایمرها توسط شرکت Taq Copenhagen دانمارک صورت پذیرفت.

جدول ‏25: مشخصات پرایمرهای طراحی شده
ژن
توالی پرايمر (‘5 به ‘3)
طول پرایمر
(nt)
طول قطعه PCR (bp)
دمای ذوب157
((C)
Gata6
F: CAGGGGTAGGGGCATCAGTG
20
118
5/63

R: GCAGGGGAGGACAGACTGAC
20

5/63
Grb2
F: CACGGGTGGCATTGTGTGTC
20
101
4/61

R: AAGCAGGGGGGAAGGGAATC
20

4/61
B2m
F: CCTGGTCTTTCTGGTGCTTGT
21
118
8/59

R: GCAGTTCAGTATGTTCGGCTTC
22

3/60

2-6-4 رقیقسازی پرایمرها
آمادهسازی پرایمرها، طبق دستورالعمل شرکت، انجام و پرایمرهایی با غلظت lµpmol/ 100 حاصل شد. سپس این پرایمرها 20 برابر رقیق گشتند و با غلظت lµpmol/ 5 در مراحل بعدی مورد استفاده قرار گرفتند.

2-6-5 واکنش زنجیرهای پلیمراز158
برای بررسی صحت ساخت cDNA، واکنش زنجیرهای پلیمراز با حجم نهایی lµ 15 و با استفاده از کیت (190301, Ampliqon) انجام گرفت. بدین منظور مواد درج شده درجدول ‏26، با یکدیگر ترکیب شدند و میکروتیوب حاوی این مواد، تحت شرایط دمایی و زمانی ذکر شده درجدول ‏27 درون دستگاه ترموسایکلر قرار گرفت و تکثیر صورت پذیرفت.

جدول ‏26: مواد مورد نیاز جهت انجام واکنش زنجیرهای پلیمراز
ماده
حجم (lµ)
Master Mix 2 Mm MgCl2 (2X)
5/7
آب عاری از نوکلئاز
1/5
cDNA
1
پرایمر رفت (pmol/µl 5)
7/0
پرایمر برگشت (pmol/µl 5)
7/0
حجم نهايي
15

جدول ‏27: چرخههای حرارتی مراحلPCR
مرحله
دما ((C)
زمان (S)
تعداد چرخه
واسرشتگی اولیه159
94
180
1
تکثیر160
واسرشت161
94
30
40

اتصال
58
30

2-6-6 ژل الکتروفورز162 محصولات PCR
جهت بررسی محصولات 163PCR، از ژل الکتروفورز استفاده شد. در ابتدا محلول آگارز 5/1%، با اضافه کردن g 5/1 پودر آگارز (16500, Invitrogen) به ml100 بافر (x 5/0) TBE164 (پیوست ب)، تهیه گردید. سپس این محلول، که با استفاده از حرارت یکنواخت شده بود، درون سینی165 الکتروفورز ریخته شد. شانهی مخصوص الکتروفورز، قبل از ریخته شدن محلول آگارز، درون سینی قرار داده شد و پس از سرد شدن ژل، از آن خارج گردید. به این ترتیب، چاهکهای مخصوص بارگذاری166 محصولات شکل گرفتند. در این مرحله، ژل درون تانک الکتروفورز (Bio-rad, America) حاوی بافر (x 5/0) TBE قرار داده شد. پس از بارگذاری محصولات PCR و نشانگر وزن مولکولی 167DNA با اندازهی bp 100 (Thermo Scientific, SM0241, America) درون چاهکهای ژل، تانک الکتروفورز به مدت یک ساعت به منبع تغذیه168 با ولتاژ V 100 متصل گردید. پس از گذشت این مدت زمان، جهت مشاهدهی قطعات تکثیر شده، ژل از تانک خارج و به مدت 10 دقیقه درون محلول اتیدیوم بروماید169 با غلظتg/ml µ 5/0 قرار داده شد. ژل مورد نظر، پس از شستوشو در ظرف حاوی آب، درون دستگاه مستند سازی ژل170تحت UV قرار گرفت.

2-6-7 واکنش زنجیرهای پلیمراز در زمان واقعی171
بهمنظور بررسی میزان بیان ژنهای مورد نظر، تکنیک Real Time PCR با روش SYBR Green و با استفاده از کيت (25344, Intron) در دستگاه ABI (Applied Bio Systems StepOne, USA) انجام شد. ابتدا برای تعیین کارایی پرایمرها در تکثیر، منحنی استاندارد172 رسم شد. برای این کار، از محصول PCR مخصوص هر ژن، رقت سریالی 1:4 تهیه شد. سپس مواد مورد نیاز (جدول ‏28) جهت انجام واکنشی به حجم lµ 15، درون میکروتیوب با یکدیگر ترکیب شدند و تحت شرایط ذکر شده در جدول ‏29 درون این دستگاه قرار گرفتند. برنامهی دستگاه بر روی منحنی استاندارد تنظیم شد.
پس از رسم منحنی استاندارد و اطمینان از کارایی پرایمرها، واکنش Real Time PCR با هدف بدست آوردن سیکل آستانه173 (چرخهای که در آن، سیگنال فلئورسنت دریافتی، از سیگنال زمینه بیشتر شود) و میزان تغییرات بیان ژنها انجام گرفت. در اینجا دستگاه بر روی CT نسبی تنظیم شد و به جای رقت سازی و استفاده از محصول PCR، از cDNA ساخته شده در بخش 2-6-3 استفاده گردید.

جدول ‏28:مواد مور
د نیاز جهت انجام Real Time PCR
ماده
حجم (lµ)
Master Mix (2X)
5/7
ROX Dye (50 µM)
3/0
آب عاری از نوکلئاز
8/3
محصولPCR
2
پرایمر رفت (pmol/µl 5)
7/0
پرایمر برگشت (pmol/µl 5)
7/0
حجم نهایی
15

جدول ‏29: چرخههای حرارتی Real Time PCR
مرحله
دما ((C)
زمان (S)
تعداد چرخه
فعالسازی آنزیم
95
120
1
چرخهها حرارتی
واسرشت
95
10
40

اتصال
58
30

رسم منحنی ذوب174
واسرشت
95
15
1

اتصال
58
60

پس از اتمام فرایند Real Time PCR، از طریق نرمافزار مرتبط با دستگاه ABI (StepOneTM Software v.2.3) منحنی ذوب نمونه ها بررسی و CT مربوط به آنها استخراج شد. تغییرات بیان ایجاد شده در ژنها، با استفاده از روابط زیر بدست آمد.

2-7 طراحی آزمایش175
2-7-1 بررسی اثرات کاهش مایع بلاستوسل رویانهای درونتنی موش، قبل از انجماد شیشهای
به این منظور بلاستوسیستهای درونتنی (‏2-3-5) پس از انتخاب، بهطور تصادفی به پنج گروه تقسیم شدند. گروه اول بلاستوسیستهایی که مطابق ‏2-5-1 و ‏2-5-2 منجمد و ذوب گشتند. گروه دوم بلاستوسیستهایی که بدون غوطهوری در ازت مایع، فقط در معرض محیطهای انجماد و ذوب (‏2-5-1-1 و‏2-5-2-1) قرار گرفتند (گروه کنترل سمیت176)، بلاستوسیستهایی که قبل از انجماد شیشهای، توسط دستگاه ریزدستکاری و با استفاده از ریزسوزن (بخش 2-4) بهطور مصنوعی سوراخ شدند (انجماد/AC) و گروهی که پس از سوراخ کردن مصنوعی، به محیط کشت برگشتند و انجماد شیشهای بر روی آنها صورت نگرفت (AC). هر چهار گروه، بعد از اعمال تیمار، به مدت 12 ساعت در محیط کشت قرار گرفتند. بلاستوسیستهای گروه کنترل نیز بدون اعمال هیچ تیماری، این مدت زمان را در شرایط کشت مشابه با گروههای قبل سپری کردند. پس از گذشت این مدت زمان، بلاستوسیستها، از نظر نرخ زندهمانی، خروج از زونا و میزان بیان ژنهای Gata6 و Grb2 مورد ارزیابی قرار گرفتند.

2-7-2 بررسی اثرات کاهش مایع بلاستوسل رویانهای برونتنی موش، قبل از انجماد شیشهای
در این آزمایش، بلاستوسیستهای حاصل از لقاح و کشت آزمایشگاهی (‏2-2-3و ‏2-2-4) بهصورت تصادفی به چهار گروه تقسیم شدند: گروه انجماد شیشهای، گروه انجماد/ AC، ، گروه AC و گروه کنترل. در این آزمایش نیز هر سه گروه پس از اعمال تیمار به مدت 12 ساعت در محیط کشت قرار گرفتند و سپس همراه با گروه کنترل، از نظر نرخ زندهمانی، خروج از زونا و میزان بیان ژن، بررسی شدند.

2-7-3 آنالیز آماری
دادههای حاصل از هر آزمایش با حداقل سه مرتبه تکرار، توسط نرمافزار آماری SPSS, ver. 16.0 (Statistical Package for the Cocial Sciences) مورد بررسی قرار گرفتند و براساس رابطهی 177SD±Mean گزارش شدند. تست Duncan برای بررسیهای چندگانه و t-test برای بررسی دو گروه استفاده گردید. در همهی نمونهها، تفاوت در 05/0 pمعنیدار در نظر گرفته شد.

3 نتایج

3-1 بررسی اثرات کاهش مایع بلاستوسل رویانهای درونتنی موش قبل از انجماد شیشهای
در این آزمایش، ابتدا کیفیت بلاستوسیستها از نظر میزان زندهمانی و خروج از زونا بررسی شد. سپس ارزیابیهای مولکولی به وسیلهی Real Time PCR بر روی آنها صورت پذیرفت.

3-1-1 نرخ زندهمانی و خروج از زونا
در این بخش از آزمایش، 733 بلاستوسیست مورد بررسی قرارگرفت. نتایج حاصل از این بررسیها (جدول ‏31)، تفاوت معنیداری در میزان زندهمانی گروههای مورد آزمایش نشان نداد (227/0 p =). در مورد میزان خروج از زونا این موضوع کاملا متفاوت بود. بلاستوسیستهایی که قبل از فرایند انجماد سوراخ شده بودند نرخ خروج از زونای بالاتری (05/0 p) نسبت به گروه انجماد شیشهای داشتند (96/2 / 96/58 در مقابل 4/1 / 44/42). هرچند این نرخ همچنان نسبت به گروه کنترل (45/1 / 6/68) بهطور معنیداری پایینتر بود. میزان خروج از زونا در گروه کنترل سمیت (4/2 / 50) نسبت به گروه انجمادی افزایش ولی نسبت به گروههای انجماد/AC و کنترل، کاهش معنیداری نشان داد. اما درگروه AC، تیمار اعمال شده موجب افزایش معنیدار نرخ خروج از زونا (72/1 / 46/83) نسبت به گروه کنترل شد (05/0p ). شکل ‏31 بلاستوسیستهای قرار گرفته در مراحل مختلف را پس از انجماد- ذوب نشان میدهد.

جدول ‏31: تاثیر تیمارهای مختلف برروی میزان زندهمانی و میزان خروج از زونای بلاستوسیست درونتنی موش
گروه مورد آزمایش
تعداد بلاستوسیستها
میزان زندهمانی (%)
میزان خروج از زونا (%)
کنترل
198
72/0 / 48/99
a45/116/68
انجماد شیشهای
137
13/2/80/97
b15/221/44
کنترل سمیت
120
03/2 /62/97
c4/2 / 50
ACA
136
84/1 /93/98
d72/1146/83
انجماد/ACA
142
11/1 / 50/99
e96/2 / 96/58
. (p تفاوت معنیدار بین گروهها را نشان میدهند (05/0a,b,c,d,eدادههاحاصل میانگین 5 تکرار میباشند.
Artificial Collapse A

شکل ‏31: بلاستوسیستهای درونتنی موش بعد از انجماد-ذوب در محیط KSOM. 1: بلاستوسیست گسترش یافته 2: بلاستوسیست در حال خروج از زونا 3: بلاستوسیست خارج شده از زونا (بزرگنمایی 400×).

3-1-2 بیان نسبی ژنهای Gata6 و Grb2

3-1-2-1 واکنش زنجیرهای پلیمراز
نتایج حاصل از الکتروفورز محصولات PCR درشکل ‏32 نشان داده شده است. در ستون 1 نشانگر وزن مولکولی DNA و در ستونهای 2، 3 و 4 به ترتیب محصولات PCR ژنهای Gata6، Grb2 و B2m نمایش داده شده است.این تصویر تاییدیهای برای صحت انجام مراحل ابتدایی کار (‏2-6-1،‏2-6-2 و ‏2-6-5) میباشد و نشان میدهد که ساخت cDNA و همچنین عملکرد پرا
یمرها در دمای C 58 به درستی انجام شده است.

شکل ‏32: الکتروفورز محصولات PCR بر روی ژل آگارز 5/1 درصد. 1: نشانگر وزن مولکولی DNA. 2: ژن Gata6 (bp118). 3: ژن Grb2 (bp 101). 4: ژن B2m (bp 118). 5: کنترل منفی Gata6. 6: کنترل منفی Grb2. 7: کنترل منفی B2m.

3-1-2-2 واکنش زنجیرهای پلیمراز در زمان واقعی
با رسم منحنی استاندارد (شکل ‏33) کارایی پرایمرهای ژنهای Gata6، Grb2 و B2m بدست آمد (به ترتیب 98/104، 73/107 و 003/103%).

شکل ‏33: منحنی استاندارد ژنهای Grb2، Gata6 و B2m با استفاده از سری رقت 1:4 نمونه.

پس از رسم منحنی استاندارد، میزان تغییر بیان ژنهای مورد نظر در گروههای مورد آزمایش بررسی شد. درشکل ‏34 و شکل ‏35 مثالهایی از منحنی تکثیر و منحنی ذوب مربوط به این ژنها آورده شده است.
از آنجایی که رنگ SYBR Green مورد استفاده در واکنش، شناساگر غیراختصاصی است و به هر DNA دورشتهای متصل میشود، بررسی منحنی ذوب برای اطمینان یافتن از تکثیر صحیح و اختصاصی محصولات الزامی میباشد. در منحنیهای شکل ‏35، هر پیک نمایانگر یک محصول با دمای ذوب مشخص است که تکثیر اختصاصی محصولات مورد نظر را تایید میکند.

شکل ‏34: منحنی تکثیر ژنهای Grb2، Gata6 و B2m

شکل ‏35: منحنیهای ذوب مربوط به ژنهای Grb2، Gata6،B2m. Tm مربوط به هر محصول، با دایرهی قرمز مشخص شده است.

پس از اطمینان یافتن از اختصاصی بودن محصولات، CTمربوط به نمونهها استخراج شد و با استفاده از معادلهی 2-1 تغییرات بیان ژنهای Gata6 و Grb2 در گروههای مورد آزمایش محاسبه شد. همانطور که در شکل ‏36 نشان داده شده است، بیان Gata6 در گروههای کنترل سمیت و انجماد شیشهای نسبت به گروه کنترل افزایش داشت (به ترتیب 71/4 و 12/5) (05/0 p). درحالیکه در گروه انجماد/AC افزایش بیان مشاهده شده (45/1 برابر) نسبت به گروه کنترل معنیدار نبود (211/0 = p). در مورد Grb2 (شکل ‏37) نیز گروههای کنترل سمیت و انجماد شیشهای به ترتیب افزایش بیان 19/2 و 56/2 برابری را نسبت به گروه کنترل نشان دادند (05/0 p). در اینجا نیز افزایش بیان مشاهده شده در گروه انجماد/AC (005/1 برابر) نسبت به گروه کنترل معنیدار نبود (966/0 p =).

شکل ‏36: اثر تیمارهای مورد آزمایش بر روی بیان نسبی ژن Gata6، در بلاستوسیستهای درونتنی موش. دادهها حاصل از سه تکرار real time RT-PCR میباشند. a, b تفاوت معنیدار بین گروهها را نشان میدهند (05/0 p).

شکل ‏37: اثر تیمارهای مورد آزمایش بر روی بیان نسبی ژن Grb2، در بلاستوسیستهای درونتنی موش. دادهها حاصل از سه تکرار real time RT-PCR میباشند. a, b تفاوت معنیدار بین گروهها را نشان میدهند (05/0 p).

3-2 بررسی اثرات کاهش مایع بلاستوسل رویانهای برونتنی موش قبل از انجماد شیشهای
3-2-1 نرخ زندهمانی و خروج از زونا
این مطالعه بر روی 535 بلاستوسیست انجام شد. مراحل رشد سلول تخم تا بلاستوسیست درون محیط کشت، در شکل ‏38


دیدگاهتان را بنویسید